GMNN/Geminin cDNA ORF Clone, Human, N-HA tag

Cat: HG14935-NY

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All GMNN/Geminin Reagents

CRO Services

Product recommended


All GMNN/Geminin Reagents

GMNN/Geminin cDNA ORF Clone, Human, N-HA tag General Information

Gene

Species
Human
NCBI Ref Seq
RefSeq ORF Size
630 bp
Description
Full length Clone DNA of Human geminin, DNA replication inhibitor with N terminal HA tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GMNN/Geminin cDNA ORF Clone, Human, N-HA tag Alternative Names

Gem cDNA ORF Clone, Human

GMNN/Geminin Background Information

Full Name
geminin, DNA replication inhibitor

GMNN/Geminin cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
GMNN/Geminin cDNA ORF Clone in Cloning Vector, Rat RG80801-U
GMNN/Geminin cDNA ORF Clone, Rat, untagged RG80801-UT
GMNN/Geminin cDNA ORF Clone, Rat, C-GFPSpark® tag RG80801-ACG
GMNN/Geminin Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80801-ACGLN
GMNN/Geminin cDNA ORF Clone, Rat, N-GFPSpark® tag RG80801-ANG
GMNN/Geminin cDNA ORF Clone, Rat, C-OFPSpark® tag RG80801-ACR
GMNN/Geminin cDNA ORF Clone, Rat, N-OFPSpark® tag RG80801-ANR
GMNN/Geminin cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80801-CF
GMNN/Geminin cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80801-NF
GMNN/Geminin cDNA ORF Clone, Rat, C-His tag RG80801-CH
GMNN/Geminin cDNA ORF Clone, Rat, N-His tag RG80801-NH
GMNN/Geminin cDNA ORF Clone, Rat, C-HA tag RG80801-CY
GMNN/Geminin cDNA ORF Clone, Rat, N-HA tag RG80801-NY
GMNN/Geminin cDNA ORF Clone, Rat, C-Myc tag RG80801-CM
GMNN/Geminin cDNA ORF Clone, Rat, N-Myc tag RG80801-NM
GMNN/Geminin qPCR Primer Pairs, Rat RP300765

GMNN/Geminin cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
GMNN/Geminin cDNA ORF Clone in Cloning Vector, Mouse MG53893-U
GMNN/Geminin cDNA ORF Clone, Mouse, untagged MG53893-UT
GMNN/Geminin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53893-ACGLN
GMNN/Geminin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53893-ACG
GMNN/Geminin cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53893-ANG
GMNN/Geminin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53893-ACR
GMNN/Geminin cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53893-ANR
GMNN/Geminin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53893-CF
GMNN/Geminin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53893-NF
GMNN/Geminin cDNA ORF Clone, Mouse, C-His tag MG53893-CH
GMNN/Geminin cDNA ORF Clone, Mouse, N-His tag MG53893-NH
GMNN/Geminin cDNA ORF Clone, Mouse, C-HA tag MG53893-CY
GMNN/Geminin cDNA ORF Clone, Mouse, N-HA tag MG53893-NY
GMNN/Geminin cDNA ORF Clone, Mouse, C-Myc tag MG53893-CM
GMNN/Geminin cDNA ORF Clone, Mouse, N-Myc tag MG53893-NM

GMNN/Geminin cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
GMNN/Geminin cDNA ORF Clone in Cloning Vector, Human HG14935-G
GMNN/Geminin cDNA ORF Clone, Human, untagged HG14935-UT
GMNN/Geminin cDNA ORF Clone, Human, C-GFPSpark® tag HG14935-ACG
GMNN/Geminin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14935-ACGLN
GMNN/Geminin cDNA ORF Clone, Human, N-GFPSpark® tag HG14935-ANG
GMNN/Geminin cDNA ORF Clone, Human, C-OFPSpark® tag HG14935-ACR
GMNN/Geminin cDNA ORF Clone, Human, N-OFPSpark® tag HG14935-ANR
GMNN/Geminin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14935-CF
GMNN/Geminin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14935-NF
GMNN/Geminin cDNA ORF Clone, Human, C-His tag HG14935-CH
GMNN/Geminin cDNA ORF Clone, Human, N-His tag HG14935-NH
GMNN/Geminin cDNA ORF Clone, Human, C-HA tag HG14935-CY
GMNN/Geminin cDNA ORF Clone, Human, C-Myc tag HG14935-CM
GMNN/Geminin cDNA ORF Clone, Human, N-Myc tag HG14935-NM
GMNN/Geminin qPCR Primer Pairs, Human HP103564
info info
添加购物车成功! 添加购物车失败!