After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GLB1L Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_024506.3
Размер кДНК:1965bp
Описание кДНК:Full length Clone DNA of Homo sapiens galactosidase, beta 1-like with N terminal Myc tag.
Синоним гена:GLB1L
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13737-ACGRBS16764
Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13737-ACRRBS16764
Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13737-CFRBS14711
Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13737-CHRBS14711
Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13737-CMRBS14711
Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13737-CYRBS14711
Человек GLB1L Джин клон кДНК в вектор клонированияHG13737-GRBS5132
Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13737-NFRBS14711
Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13737-NHRBS14711
Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13737-NMRBS14711
Человек GLB1L Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13737-NYRBS14711
Человек GLB1L Джин ORF экспрессии кДНК клона плазмидыHG13737-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13737-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».