Быстрый заказ

Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек GLA Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_000169.2
    Размер кДНК:1290bp
    Описание кДНК:Full length Clone DNA of Homo sapiens galactosidase, alpha with N terminal Flag tag.
    Синоним гена:GALA
    Виды:Human
    переносчик:pCMV3-SP-N-FLAG
    Plasmid:
    Участок рестрикции:
    Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GLA qPCR primers for gene expression analysis, HP101606 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12078-ACGRBS15400
    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12078-ACRRBS15400
    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12078-CFRBS13340
    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12078-CHRBS13340
    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12078-CMRBS13340
    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12078-CYRBS13340
    Человек alpha-Galactosidase A Джин клон кДНК в вектор клонированияHG12078-GRBS5130
    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12078-NFRBS13340
    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12078-NHRBS13340
    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12078-NMRBS13340
    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12078-NYRBS13340
    Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмидыHG12078-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Alpha-galactosidase A, also known as Alpha-D-galactoside galactohydrolase, Alpha-D-galactosidase A, Melibiase and GLA, is a member of the glycosyl hydrolase 27 family. GLA is used as a long-term enzyme replacement therapy in patients with a confirmed diagnosis of Fabry disease. Defects in GLA are the cause of Fabry disease (FD) which is a rare X-linked sphingolipidosis disease where glycolipid accumulates in many tissues. The disease consists of an inborn error of glycosphingolipid catabolism. FD patients show systemic accumulation of globotriaoslyceramide (Gb3) and related glycosphingolipids in the plasma and cellular lysosomes throughout the body. Clinical recognition in males results from characteristic skin lesions (angiokeratomas) over the lower trunk. Patients may show ocular deposits, febrile episodes, and burning pain in the extremities. Death results from renal failure, cardiac or cerebral complications of hypertension or other vascular disease. Deficiency of GLA leads to the accumulation of glycosphingolipids in the vasculature leading to multiorgan pathology. In addition to well-described microvascular disease, deficiency of GLA is also characterized by premature macrovascular events such as stroke and possibly myocardial infarction.

    Ссылки
  • Koide T.et al., 1990, FEBS Lett. 259:353-356.
  • Yang C.-C. et al., 2003, Clin. Genet. 63:205-209.
  • Verovnik F. et al.,2004, Eur. J. Hum. Genet. 12:678-681.
  • Nance C.S. et al., 2006, Arch. Neurol. 63:453-457.
  • Size / Price
    Каталог: HG12078-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».