Быстрый заказ

Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GLA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000169.2
Размер кДНК:1290bp
Описание кДНК:Full length Clone DNA of Homo sapiens galactosidase, alpha with C terminal HA tag.
Синоним гена:GALA
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12078-ACGRBS15400
Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12078-ACRRBS15400
Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12078-CFRBS13340
Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12078-CHRBS13340
Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12078-CMRBS13340
Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12078-CYRBS13340
Человек alpha-Galactosidase A Джин клон кДНК в вектор клонированияHG12078-GRBS5130
Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12078-NFRBS13340
Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12078-NHRBS13340
Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12078-NMRBS13340
Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12078-NYRBS13340
Человек alpha-Galactosidase A Джин ORF экспрессии кДНК клона плазмидыHG12078-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Alpha-galactosidase A, also known as Alpha-D-galactoside galactohydrolase, Alpha-D-galactosidase A, Melibiase and GLA, is a member of the glycosyl hydrolase 27 family. GLA is used as a long-term enzyme replacement therapy in patients with a confirmed diagnosis of Fabry disease. Defects in GLA are the cause of Fabry disease (FD) which is a rare X-linked sphingolipidosis disease where glycolipid accumulates in many tissues. The disease consists of an inborn error of glycosphingolipid catabolism. FD patients show systemic accumulation of globotriaoslyceramide (Gb3) and related glycosphingolipids in the plasma and cellular lysosomes throughout the body. Clinical recognition in males results from characteristic skin lesions (angiokeratomas) over the lower trunk. Patients may show ocular deposits, febrile episodes, and burning pain in the extremities. Death results from renal failure, cardiac or cerebral complications of hypertension or other vascular disease. Deficiency of GLA leads to the accumulation of glycosphingolipids in the vasculature leading to multiorgan pathology. In addition to well-described microvascular disease, deficiency of GLA is also characterized by premature macrovascular events such as stroke and possibly myocardial infarction.

Ссылки
  • Koide T.et al., 1990, FEBS Lett. 259:353-356.
  • Yang C.-C. et al., 2003, Clin. Genet. 63:205-209.
  • Verovnik F. et al.,2004, Eur. J. Hum. Genet. 12:678-681.
  • Nance C.S. et al., 2006, Arch. Neurol. 63:453-457.
  • Size / Price
    Каталог: HG12078-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».