After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GIF Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC037958
Размер кДНК:1254bp
Описание кДНК:Full length Clone DNA of Homo sapiens gastric intrinsic factor (vitamin B synthesis) with C terminal Myc tag.
Синоним гена:IF, INF, IFMH, TCN3, GIF
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13544-ACGRBS15396
Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13544-ACRRBS15396
Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13544-CFRBS13343
Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13544-CHRBS13343
Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13544-CMRBS13343
Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13544-CYRBS13343
Человек Gastric intrinsic factor / GIF Джин клон кДНК в вектор клонированияHG13544-GRBS5132
Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13544-NFRBS13343
Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13544-NHRBS13343
Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13544-NMRBS13343
Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13544-NYRBS13343
Человек Gastric intrinsic factor / GIF Джин ORF экспрессии кДНК клона плазмидыHG13544-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Gastric intrinsic factor, also known as GIF, belongs to the of the cobalamin transport protein family. It is a glycoprotein produced by the parietal cells of the stomach. Gastric intrinsic factor plays a key role in the absorption of vitamin B12 on in the small intestine. Vitamin B12 bounds to haptocorrin after entry into the stomach. The resulting complex enters the duodenum, where pancreatic enzymes digest haptocorrin. In the less acidic environment of the small intestine, B12 can then bind to gastric intrinsic factor. This new complex travels to the ileum, where special epithelial cells endocytose them. Inside the cell, B12 dissociates once again and binds to another protein, transcobalamin II. The new complex can exit the epithelial cells to enter the liver.

Ссылки
  • Gerdin AK. (2010) The Sanger Mouse Genetics Programme: high throughput characterisation of knockout mice. Acta Opthalmologica. 88:925-7.
  • AU - Berlin H, et al. (1968) ORAL TREATMENT OF PERNICIOUS ANEMIA WITH HIGH DOSES OF VITAMIN B12 WITHOUT INTRINSIC FACTOR. Acta Medica Scandinavica. 184(1-6):247-58.
  • Hewitt JE, et al. (1991) Human gastric intrinsic factor: characterization of cDNA and genomic clones and localization to human chromosome 11. Genomics. 10(2):432-40.
  • Size / Price
    Каталог: HG13544-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».