Быстрый заказ

Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GGH Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003878.2
Размер кДНК:957bp
Описание кДНК:Full length Clone DNA of Homo sapiens gamma-glutamyl hydrolase (conjugase, folylpolygammaglutamyl hydrolase) with C terminal HA tag.
Синоним гена:GH, GGH
Виды:Human
переносчик:pCMV3-C-HA
Plasmid:
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12068-ACGRBS15400
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12068-ACRRBS15400
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12068-CFRBS13340
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12068-CHRBS13340
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12068-CMRBS13340
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12068-CYRBS13340
Человек GGH/Glutamyl hydrolase gamma Джин клон кДНК в вектор клонированияHG12068-GRBS5130
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмидыHG12068-G-NRBS13340
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12068-NFRBS13340
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12068-NHRBS13340
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12068-NMRBS13340
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12068-NYRBS13340
Человек GGH/Glutamyl hydrolase gamma Джин ORF экспрессии кДНК клона плазмидыHG12068-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12068-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».