After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GFRA2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001495.4
Размер кДНК:1395bp
Описание кДНК:Full length Clone DNA of Homo sapiens GDNF family receptor alpha 2 with C terminal Flag tag.
Синоним гена:NTNRA, RETL2, TRNR2, GDNFRB, NRTNR-ALPHA
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10331-ACGRBS15400
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10331-ACRRBS15400
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10331-CFRBS13340
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10331-CHRBS13340
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10331-CMRBS13340
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10331-CYRBS13340
Человек GFRA2 Джин клон кДНК в вектор клонированияHG10331-MRBS5130
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10331-M-FRBS13340
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмидыHG10331-M-NRBS13340
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10331-NFRBS13340
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10331-NHRBS13340
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10331-NMRBS13340
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10331-NYRBS13340
Человек GFRA2 Джин ORF экспрессии кДНК клона плазмидыHG10331-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

GFRA2 is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol(GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA2 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA/GDNFRa acts as the ligand-binding component. Experiments have improved that GFRA2 genetic variants and age may play a role in Tardive dyskinesia (TD) susceptibility, but further work is required to confirm these findings.

Ссылки
  • Jing S, et al. (1997) GFRalpha-2 and GFRalpha-3 are two new receptors for ligands of the GDNF family. J Biol Chem. 272(52): 33111-7.
  • Souza RP, et al. (2010) Glial cell line-derived neurotrophic factor receptor alpha 2 (GFRA2) gene is associated with tardive dyskinesia. Psychopharmacology. 210(3): 347-54.
  • Vanhorne JB, et al. (2001) Cloning and characterization of the human GFRA2 locus and investigation of the gene in Hirschsprung disease. Hum Genet. 108(5): 409-15.
  • Size / Price
    Каталог: HG10331-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».