Быстрый заказ

Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GFRA1 Информация о продукте «Клон cDNA»
Размер кДНК:1383bp
Описание кДНК:Full length Clone DNA of Homo sapiens GDNF family receptor alpha 1, transcript variant 2 with C terminal Flag tag.
Синоним гена:GDNFR, RET1L, RETL1, TRNR1, GDNFRA, MGC23045, GFR-ALPHA-1
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10330-ACGRBS15400
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10330-ACRRBS15400
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10330-CFRBS13340
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10330-CHRBS13340
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10330-CMRBS13340
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10330-CYRBS13340
Человек GFRA1 transcript variant 2 Джин клон кДНК в вектор клонированияHG10330-MRBS5130
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10330-M-FRBS13340
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10330-NFRBS13340
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10330-NHRBS13340
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10330-NMRBS13340
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10330-NYRBS13340
Человек GFRA1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG10330-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Glial cell line derived neurotrophic factor (GDNF) Family Receptor Alpha 1 (GFRA1) is a member of the GDNF receptor family. It is a glycosylphosphatidylinositol (GPI)-linked cell surface receptor for both GDNF and NTN, and mediates activation of the RET tyrosine kinase receptor. GFRA1 is a potent survival factor for central and peripheral neurons, and is essential for the development of kidneys and the enteric nervous system. Glial cell line-derived neurotrophic factor (GDNF) and neurturin (NTN) are its binding ligand which are two structurally related, potent neurotrophic factors that play key roles in the control of neuron survival and differentiation. GDNF promotes the formation of a physical complex between GFRA/GDNFRa and the orphan tyrosin kinase receptor Ret, thereby inducing its tyrosine phosphorylation. The RET is a receptor tyrosine kinase representing the signal-transducing molecule of a multisubunit surface receptor complex for the GDNF, in which GFRA / GDNFRa acts as the ligand-binding component. GDNF, a distantly related member of the transforming growth factor-β (TGF-â) superfamily, and its receptor components: GFRA1, Ret and neural cell adhesion molecule (NCAM) have been recently reported to be expressed in the testis and to be involved in the proliferation regulation of immature Sertoli cells.

  • Jing S, et al. (1997) GFRalpha-2 and GFRalpha-3 are two new receptors for ligands of the GDNF family. J Biol Chem. 272(52): 33111-7.
  • Jing S, et al. (1996) GDNF-induced activation of the ret protein tyrosine kinase is mediated by GDNFR-alpha, a novel receptor for GDNF. Cell. 85(7):1113-24.
  • Treanor JJ, et al. (1996) Characterization of a multicomponent receptor for GDNF. Nature. 382(6586): 80-3.
  • Size / Price
    Каталог: HG10330-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.