Быстрый заказ

Text Size:AAA

Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GFAP Информация о продукте «Клон cDNA»
Размер кДНК:1299bp
Описание кДНК:Full length Clone DNA of Homo sapiens glial fibrillary acidic protein with C terminal Myc tag.
Синоним гена:FLJ42474, FLJ45472, GFAP
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12167-ACGRBS15400
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12167-ACRRBS15400
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12167-ANGRBS15400
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12167-ANRRBS15400
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12167-CFRBS13340
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12167-CHRBS13340
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12167-CMRBS13340
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12167-CYRBS13340
Человек GFAP Джин клон кДНК в вектор клонированияHG12167-GRBS5130
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12167-NFRBS13340
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12167-NHRBS13340
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12167-NMRBS13340
Человек GFAP Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12167-NYRBS13340
Человек GFAP Джин ORF экспрессии кДНК клона плазмидыHG12167-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

GFAP is a cell-specific marker which belongs to the intermediate filament family. It can distinguish astrocytes from other glial cells during development. GFAP is expressed in cells lacking fibronectin. It is a type III intermediate filaments protein which contains three domains: the head, rod and tail domains. GFAP functions in many important entral nervous system (CNS) processes, including cell communication and the functioning of the blood brain barrier. Improper GFAP regulation can cause multiple disorders. Defects in GFAP is related to Alexander disease which is a rare disorder of the central nervous system. It is a progressive leukoencephalopathy whose hallmark is the widespread accumulation of Rosenthal fibers which are cytoplasmic inclusions in astrocytes.

  • Buniatian G, et al., 1998, Biology of the cell. 90(1): 53-61.
  • Chen YS, et al., 2011, Experimental Cell Research. 317(16): 2252-66.
  • Isaacs A, et al., 1998, Genomics. 51(1): 152-4.
  • Size / Price
    Каталог: HG12167-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.