After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human GDPD3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_024307.2
Размер кДНК:957bp
Описание кДНК:Full length Clone DNA of Homo sapiens glycerophosphodiester phosphodiesterase domain containing 3.
Синоним гена:GDPD3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16157-ACGRBS15400
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16157-ACRRBS15400
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16157-CFRBS13340
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16157-CHRBS13340
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16157-CMRBS13340
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16157-CYRBS13340
Человек GDPD3 Джин клон кДНК в вектор клонированияHG16157-GRBS5130
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16157-NFRBS13340
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16157-NHRBS13340
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16157-NMRBS13340
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16157-NYRBS13340
Человек GDPD3 Джин ORF экспрессии кДНК клона плазмидыHG16157-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16157-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».