Быстрый заказ

Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек GDF3 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_020634.1
    Размер кДНК:1095bp
    Описание кДНК:Full length Clone DNA of Homo sapiens growth differentiation factor 3 with C terminal HA tag.
    Синоним гена:GDF3
    Виды:Human
    переносчик:pCMV3-C-HA
    Plasmid:
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GDF3 qPCR primers for gene expression analysis, HP100513 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10492-ACGRBS15400
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10492-ACRRBS15400
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10492-CFRBS13340
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10492-CHRBS13340
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10492-CMRBS13340
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10492-CYRBS13340
    Человек GDF-3 Джин клон кДНК в вектор клонированияHG10492-MRBS5130
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10492-M-FRBS13340
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10492-NFRBS13340
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10492-NHRBS13340
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10492-NMRBS13340
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10492-NYRBS13340
    Человек GDF-3 Джин ORF экспрессии кДНК клона плазмидыHG10492-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG10492-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».