After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GCSH Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC000790
Размер кДНК:522bp
Описание кДНК:Full length Clone DNA of Homo sapiens glycine cleavage system protein H (aminomethyl carrier) with N terminal Flag tag.
Синоним гена:GCE, NKH
Виды:Human
переносчик:pCMV3-N-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14568-ACGRBS15400
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14568-ACRRBS15400
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14568-ANGRBS15400
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14568-ANRRBS15400
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14568-CFRBS13340
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14568-CHRBS13340
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14568-CMRBS13340
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14568-CYRBS13340
Человек GCSH Джин клон кДНК в вектор клонированияHG14568-GRBS5130
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14568-NFRBS13340
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14568-NHRBS13340
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14568-NMRBS13340
Человек GCSH Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14568-NYRBS13340
Человек GCSH Джин ORF экспрессии кДНК клона плазмидыHG14568-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Degradation of glycine is brought about by the glycine cleavage system, which is composed of four mitochondrial protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). GCSH is the H protein, which transfers the methylamine group of glycine from the P protein to the T protein. Defects in GCSH gene are a cause of nonketotic hyperglycinemia (NKH). Two transcript variants, one protein-coding and the other probably not protein-coding,have been found for GCSH gene. Also, several transcribed and non-transcribed pseudogenes of GCSH gene exist throughout the genome.

Ссылки
  • Hiraga K. et al., 1988, Biochem Biophys Res Commun. 151 (2): 758-62.
  • Fujiwara K. et al., 1991, Biochem Biophys Res Commun. 176 (2): 711-6.
  • Koyata H. et al., 1991, Am J Hum Genet. 48 (2): 351-61.
  • Size / Price
    Каталог: HG14568-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        Недавно просмотренные товары
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».