Быстрый заказ

Text Size:AAA

Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GBP2 Информация о продукте «Клон cDNA»
Размер кДНК:1776bp
Описание кДНК:Full length Clone DNA of Homo sapiens guanylate binding protein 2, interferon-inducible with C terminal Flag tag.
Синоним гена:DKFZp451C2311, GBP2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13930-ACGRBS16764
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13930-ACRRBS16764
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13930-ANGRBS16764
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13930-ANRRBS16764
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13930-CFRBS14711
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13930-CHRBS14711
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13930-CMRBS14711
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13930-CYRBS14711
Человек GBP-2 Джин клон кДНК в вектор клонированияHG13930-GRBS5132
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13930-NFRBS14711
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13930-NHRBS14711
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13930-NMRBS14711
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13930-NYRBS14711
Человек GBP-2 Джин ORF экспрессии кДНК клона плазмидыHG13930-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name

GBP-2 belongs to the guanylate-binding protein (GBP) family. GBPs are characterized by their ability to specifically bind guanine nucleotides (GMP, GDP, and GTP). As GTPases induced by IFN-gamma (Interferon-inducible GTPase), they are key to the protective immunity against microbial and viral pathogens. GBP-2 is a GTPase that converts GTP to GDP and GMP. It binds GTP, GDP and GMP. GBP-2 hydrolyzes GTP very efficiently. GDP rather than GMP is the major reaction product. GBP-2 is induced by interferons that have antiviral effects and inhibit tumor cell proliferation.

  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Wistow G, et al. (2002) Expressed sequence tag analysis of human RPE/choroid for the NEIBank Project: over 6000 non-redundant transcripts, novel genes and splice variants. Mol Vis. 8:205-20.
  • Neun R, et al. (1996) GTPase properties of the interferon-induced human guanylate-binding protein 2. FEBS Lett. 390(1):69-72.
  • Size / Price
    Каталог: HG13930-CF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.