GBA/glucocerebrosidase cDNA ORF Clone, Human, C-His tag

1/1
Price:
Size:
Number:

GBA/glucocerebrosidase cDNA ORF Clone, Human, C-His tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1656 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human glucosidase, beta, acid with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Restriction Sites
HindIII(two restriction sites) + XbaI(6kb+1.53kb+0.15kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

GBA/glucocerebrosidase cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

GBA/glucocerebrosidase cDNA ORF Clone, Human, C-His tag: Validated Images

GBA/glucocerebrosidase cDNA ORF Clone, Human, C-His tag: Alternative Names

GBA1 cDNA ORF Clone, Human; GCB cDNA ORF Clone, Human; GLUC cDNA ORF Clone, Human

GBA/glucocerebrosidase Background Information

Mutations in the GBA gene, encoding the lysosomal hydrolase glucocerebrosidase (GCase), are the most common known genetic risk factor for Parkinson's disease (PD) and dementia with Lewy bodies (DLB). ASAH1 (acid ceramidase 1) and GBA2 (glucocerebrosidase 2) enzymes that mediate glucosylsphingosine production and metabolism are attractive therapeutic targets for treating mutant GBA-associated PD.
Full Name
glucosidase, beta, acid
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait