After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human GBA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000157
Размер кДНК:1611bp
Описание кДНК:Full length Clone DNA of Homo sapiens glucosidase, beta, acid.
Синоним гена:GBA1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-GBA
Участок рестрикции:NheI + XbaI (6.1kb + 1.61kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human GBA Gene Plasmid Map
Human GBA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12038-ACGRBS16760
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12038-ACRRBS16760
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12038-CFRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12038-CHRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12038-CMRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12038-CYRBS14710
Человек GBA/glucocerebrosidase Джин клон кДНК в вектор клонированияHG12038-GRBS5130
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12038-NFRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12038-NHRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12038-NMRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12038-NYRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмидыHG12038-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12038-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human GBA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».