Быстрый заказ

Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды

  • Human GBA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
ПаспортОбзорыСвязанные продуктыПротоколы
Человек GBA Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000157
Размер кДНК:1611bp
Описание кДНК:Full length Clone DNA of Homo sapiens glucosidase, beta, acid.
Синоним гена:GBA1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-GBA
Участок рестрикции:NheI + XbaI (6.1kb + 1.61kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with GBA qPCR primers for gene expression analysis, HP101572 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек GBA Gene Plasmid Map
Human GBA Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12038-ACGRBS16760
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12038-ACRRBS16760
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12038-CFRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12038-CHRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12038-CMRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12038-CYRBS14710
Человек GBA/glucocerebrosidase Джин клон кДНК в вектор клонированияHG12038-GRBS5130
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12038-NFRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12038-NHRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12038-NMRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12038-NYRBS14710
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмидыHG12038-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12038-UT
Цена по прейскуранту: 
Цена:      (You Save: )

Datasheet & Documentation

Contact Us
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».