Быстрый заказ

Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GBA Информация о продукте «Клон cDNA»
Размер кДНК:1611bp
Описание кДНК:Full length Clone DNA of Homo sapiens glucosidase, beta, acid with C terminal His tag.
Синоним гена:GBA1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12038-ACGRBS16764
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12038-ACRRBS16764
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12038-CFRBS14711
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12038-CHRBS14711
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12038-CMRBS14711
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12038-CYRBS14711
Человек GBA/glucocerebrosidase Джин клон кДНК в вектор клонированияHG12038-GRBS5132
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12038-NFRBS14711
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12038-NHRBS14711
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12038-NMRBS14711
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12038-NYRBS14711
Человек GBA/glucocerebrosidase Джин ORF экспрессии кДНК клона плазмидыHG12038-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12038-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.