After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human GAS2L3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC043366
Размер кДНК:2085bp
Описание кДНК:Full length Clone DNA of Homo sapiens growth arrest-specific 2 like 3 DNA.
Синоним гена:G2L3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15210-ACGRBS16760
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15210-ACRRBS16760
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15210-ANGRBS16760
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15210-ANRRBS16760
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15210-CFRBS14710
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15210-CHRBS14710
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15210-CMRBS14710
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15210-CYRBS14710
Человек GAS2L3 Джин клон кДНК в вектор клонированияHG15210-GRBS5130
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15210-NFRBS14710
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15210-NHRBS14710
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15210-NMRBS14710
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15210-NYRBS14710
Человек GAS2L3 Джин ORF экспрессии кДНК клона плазмидыHG15210-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15210-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».