Быстрый заказ

Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек GAPDH Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:AF261085.1
    Размер кДНК:1008bp
    Описание кДНК:Full length Clone DNA of Homo sapiens glyceraldehyde-3-phosphate dehydrogenase with N terminal His tag.
    Синоним гена:G3PD, GAPD, HEL-S-162eP
    Виды:Human
    переносчик:pCMV3-N-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with GAPDH qPCR primers for gene expression analysis, HP100003 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10094-ACGRBS15400
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10094-ACRRBS15400
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10094-ANGRBS15400
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10094-ANRRBS15400
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10094-CFRBS13340
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10094-CHRBS13340
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10094-CMRBS13340
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10094-CYRBS13340
    Человек GAPDH Джин клон кДНК в вектор клонированияHG10094-GRBS5130
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10094-NFRBS13340
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10094-NHRBS13340
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10094-NMRBS13340
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10094-NYRBS13340
    Человек GAPDH Джин ORF экспрессии кДНК клона плазмидыHG10094-UTRBS13340
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Фон

    Glyceraldehyde 3-phosphate dehydrogenase (GAPDH or G3PDH) is an enzyme of about 37kDa that is consisdered as a cellular enzyme involved in glycolysis. It catelyzes the sixth step of glycolysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a pleiotropic enzyme that is overexpressed in apoptosis and in several human chronic pathologies. Its role as a mediator for cell death has also been highlighted. A recent report suggests that GAPDH may be genetically associated with late-onset of Alzheimer's disease. Besides, deprenyl, which has originally been used as a monoamine oxidase inhibitor for Parkinson's disease, binds to GAPDH and displays neuroprotective actions.

    Ссылки
  • Hara MR, et al. (2006) Neuroprotection by pharmacologic blockade of the GAPDH death cascade. PNA. 103 (10): 3887-9.
  • Hara MR, et al. (2006) GAPDH as a sensor of NO stress.Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 1762 (5): 502-9.
  • Tarze A, et al. (2007) GAPDH, a novel regulator of the pro-apoptotic mitochondrial membrane permeabilizationGAPDH and apoptosis. Oncogene. 26: 2606-20.
  • Yi MK, et al. (2000) Functional Significance of the Interaction of Hepatitis A Virus RNA with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH): Opposing Effects of GAPDH and Polypyrimidine Tract Binding Protein on Internal Ribosome Entry Site Function. Journal of Virology. 74 (14) : 6459-68.
  • Size / Price
    Каталог: HG10094-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».