After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GALNT14 Информация о продукте «Клон cDNA»
Размер кДНК:1659bp
Описание кДНК:Full length Clone DNA of Homo sapiens UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 14 (GalNAc-T14) with C terminal His tag.
Синоним гена:GALNT15, FLJ12691, FLJ13977, GalNac-T10, GalNac-T14, GALNT14
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11128-ACGRBS16760
Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11128-ACRRBS16760
Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11128-CFRBS14710
Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11128-CHRBS14710
Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11128-CMRBS14710
Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11128-CYRBS14710
Человек GALNT14 Джин клон кДНК в вектор клонированияHG11128-MRBS5130
Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11128-NFRBS14710
Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11128-NHRBS14710
Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11128-NMRBS14710
Человек GALNT14 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11128-NYRBS14710
Человек GALNT14 Джин ORF экспрессии кДНК клона плазмидыHG11128-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11128-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.