Быстрый заказ

Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек GALK1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000154.1
Размер кДНК:1179bp
Описание кДНК:Full length Clone DNA of Homo sapiens galactokinase 1 with N terminal His tag.
Синоним гена:GK1, GALK, GALK1
Виды:Human
переносчик:pCMV3-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with GALK1 qPCR primers for gene expression analysis, HP101262 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11383-ACGRBS15400
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11383-ACRRBS15400
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11383-ANGRBS15400
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11383-ANRRBS15400
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11383-CFRBS13340
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11383-CHRBS13340
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11383-CMRBS13340
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11383-CYRBS13340
Человек GALK1 Джин клон кДНК в вектор клонированияHG11383-MRBS5130
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11383-NFRBS13340
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11383-NHRBS13340
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11383-NMRBS13340
Человек GALK1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11383-NYRBS13340
Человек GALK1 Джин ORF экспрессии кДНК клона плазмидыHG11383-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Galactokinase, also known as Galactose kinase, GALK and GALK1, is a protein which belongs to the GHMP kinase family and GalK subfamily. Galactokinase / GALK1 is a major enzyme for galactose metabolism. Galactokinase (GALK) deficiency is an autosomal recessive disorder characterized by elevation of blood galactose concentration and diminished galactose-1-phosphate, leading to the production of galactitol. Defects in GALK1 are the cause of galactosemia II ( GALCT2 ) which II is an autosomal recessive deficiency characterized by congenital cataracts during infancy and presenile cataracts in the adult population. The cataracts are secondary to accumulation of galactitol in the lenses.

Ссылки
  • Hunter,M. et al., 2001, Hum Mutat. 17 (1):77-8.
  • Park,H.D. et al., 2007, Mol Genet Metab. 91 (3):234-8.
  • Park,H.D. et al., 2009, BMC Med Genet. 10 :29.
  • Size / Price
    Каталог: HG11383-NH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».