After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек GALC Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GALC Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000153.3
Размер кДНК:2058bp
Описание кДНК:Full length Clone DNA of Homo sapiens galactosylceramidase with N terminal His tag.
Синоним гена:GALC
Виды:Human
переносчик:pCMV3-SP-N-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек GALC Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек GALC Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13681-ACGRBS16760
Человек GALC Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13681-ACRRBS16760
Человек GALC Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13681-CFRBS14710
Человек GALC Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13681-CHRBS14710
Человек GALC Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13681-CMRBS14710
Человек GALC Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13681-CYRBS14710
Человек GALC Джин клон кДНК в вектор клонированияHG13681-GRBS5130
Человек GALC Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13681-NFRBS14710
Человек GALC Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13681-NHRBS14710
Человек GALC Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13681-NMRBS14710
Человек GALC Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13681-NYRBS14710
Человек GALC Джин ORF экспрессии кДНК клона плазмидыHG13681-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13681-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».