After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human GABRE Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC059376
Размер кДНК:1098bp
Описание кДНК:Full length Clone DNA of Homo sapiens gamma-aminobutyric acid (GABA) A receptor, epsilon with N terminal Myc tag.
Синоним гена:GABRE
Виды:Human
переносчик:pCMV3-SP-N-Myc
Plasmid:
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13733-ACGRBS15400
Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13733-ACRRBS15400
Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13733-CFRBS13340
Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13733-CHRBS13340
Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13733-CMRBS13340
Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13733-CYRBS13340
Человек GABRE/GABA Receptor Epsilon Джин клон кДНК в вектор клонированияHG13733-GRBS5130
Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13733-NFRBS13340
Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13733-NHRBS13340
Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13733-NMRBS13340
Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13733-NYRBS13340
Человек GABRE/GABA Receptor Epsilon Джин ORF экспрессии кДНК клона плазмидыHG13733-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».