Быстрый заказ

Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек GABARAPL2 Информация о продукте «Клон cDNA»
Размер кДНК:354bp
Описание кДНК:Full length Clone DNA of Homo sapiens GABA(A) receptor-associated protein-like 2 with N terminal Flag tag.
Синоним гена:ATG8, GEF2, ATG8C, GEF-2, GATE16, GATE-16
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
( We provide with GABARAPL2 qPCR primers for gene expression analysis, HP104911 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14563-ACGRBS15400
Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14563-ACRRBS15400
Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14563-CFRBS13340
Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14563-CHRBS13340
Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14563-CMRBS13340
Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14563-CYRBS13340
Человек GATE-16 / GABARAPL2 Джин клон кДНК в вектор клонированияHG14563-GRBS5130
Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14563-NFRBS13340
Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14563-NHRBS13340
Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14563-NMRBS13340
Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14563-NYRBS13340
Человек GATE-16 / GABARAPL2 Джин ORF экспрессии кДНК клона плазмидыHG14563-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

GATE-16, also known as ATG8, belongs to the MAP1 LC3 family. It is expressed at high levels in the brain, heart, prostate, ovary, spleen and skeletal muscle. GATE-16 is expressed at very low levels in lung, thymus and small intestine. GATE-16 is involved in intra-Golgi traffic. It modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1.

  • Ewing Rob M, et al. (2007) Large-scale mapping of human protein-protein interactions by mass spectrometry. Mol Syst Biol. 3(1):89.
  • Okazaki N, et al. (2000) Interaction of the Unc-51-like kinase and microtubule-associated protein light chain 3 related proteins in the brain: possible role of vesicular transport in axonal elongation. Brain Res Mol Brain Res. 85(1-2):1-12.
  • Xin Y, et al. (2001) Cloning, expression patterns, and chromosome localization of three human and two mouse homologues of GABA(A) receptor-associated protein. Genomics. 74 (3):408-13.
  • Size / Price
    Каталог: HG14563-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.