Быстрый заказ

Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

  • other Green fluorescent protein / GFP Gene Plasmid Map 5611
ПаспортОбзорыСвязанные продуктыПротоколы
Человек GABARAP Информация о продукте «Клон cDNA»
Размер кДНК:399 bp
Описание кДНК:Full length Clone DNA of Homo sapiens GABA(A) receptor-associated protein with C terminal Myc tag.
Синоним гена:MM46, ATG8A, GABARAP-a
Участок рестрикции:KpnI + XbaI(6kb+0.4kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
( We provide with GABARAP qPCR primers for gene expression analysis, HP104240 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15622-ACGRBS15400
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15622-ACRRBS15400
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15622-ANGRBS15400
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15622-ANRRBS15400
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15622-CFRBS13340
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15622-CHRBS13340
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15622-CMRBS13340
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15622-CYRBS13340
Человек GABARAP / Apg8p1 Джин клон кДНК в вектор клонированияHG15622-GRBS5130
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15622-NFRBS13340
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15622-NHRBS13340
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15622-NMRBS13340
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15622-NYRBS13340
Человек GABARAP / Apg8p1 Джин ORF экспрессии кДНК клона плазмидыHG15622-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15622-CM
Цена по прейскуранту: 
Цена:      (You Save: )
НаличиеIn Stock
Добавить в корзинуЗапрос по оптовому заказу

Datasheet & Documentation

Contact Us
    Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.