After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек G6PD Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human G6PD Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_000402.3
Размер кДНК:1638bp
Описание кДНК:Full length Clone DNA of Homo sapiens glucose-6-phosphate dehydrogenase.
Синоним гена:G6PD1, G6PD
Виды:Human
переносчик:pCMV3-untagged
Plasmid:pCMV3-G6PD-t1
Участок рестрикции:HindIII + XbaI (6.1kb + 1.64kb)
Последовательность меток:
Описание последовательности:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1401 C>T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human G6PD Gene Plasmid Map
Human G6PD Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12021-ACGRBS16760
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12021-ACRRBS16760
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12021-ANGRBS16760
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12021-ANRRBS16760
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12021-CFRBS14710
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12021-CHRBS14710
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12021-CMRBS14710
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12021-CYRBS14710
Человек G6PD Джин клон кДНК в вектор клонированияHG12021-GRBS5130
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12021-NFRBS14710
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12021-NHRBS14710
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12021-NMRBS14710
Человек G6PD Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12021-NYRBS14710
Человек G6PD Джин ORF экспрессии кДНК клона плазмидыHG12021-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12021-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human G6PD Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».