Быстрый заказ

Text Size:AAA

Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FZD3 Информация о продукте «Клон cDNA»
Размер кДНК:2001bp
Описание кДНК:Full length Clone DNA of Homo sapiens frizzled family receptor 3 with N terminal Myc tag.
Синоним гена:Fz-3
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc Метка on other vectors
Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG16092-ACGRBS16760
Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG16092-ACRRBS16760
Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG16092-CFRBS14710
Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG16092-CHRBS14710
Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG16092-CMRBS14710
Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG16092-CYRBS14710
Человек FZD3/frizzled 3 Джин клон кДНК в вектор клонированияHG16092-GRBS5130
Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG16092-NFRBS14710
Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG16092-NHRBS14710
Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG16092-NMRBS14710
Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG16092-NYRBS14710
Человек FZD3/frizzled 3 Джин ORF экспрессии кДНК клона плазмидыHG16092-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG16092-NM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.