Быстрый заказ

Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FZD1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_003505.1
Размер кДНК:1944bp
Описание кДНК:Full length Clone DNA of Homo sapiens frizzled family receptor 1 DNA.
Синоним гена:FLJ95923, DKFZp564G072, FZD1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15229-ACGRBS16760
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15229-ACRRBS16760
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15229-CFRBS14710
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15229-CHRBS14710
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15229-CMRBS14710
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15229-CYRBS14710
Человек Frizzled-1/FZD1 Джин клон кДНК в вектор клонированияHG15229-GRBS5130
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15229-NFRBS14710
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15229-NHRBS14710
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15229-NMRBS14710
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15229-NYRBS14710
Человек Frizzled-1/FZD1 Джин ORF экспрессии кДНК клона плазмидыHG15229-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Frizzled-1, also known as FZD1, belongs to the G-protein coupled receptor Fz/Smo family. FZD1 contains a signal peptide, a cysteine-rich domain in the N-terminal extracellular region, 7 transmembrane domains, and a C-terminal PDZ domain-binding motif. FZD1 is expressed in adult heart, placenta, lung, kidney, pancreas, prostate, and ovary and in fetal lung and kidney. Frizzled is a family of G protein-coupled receptor proteins that serve as receptors in the Wnt signaling pathway and other signaling pathways. When activated, Frizzled leads to activation of Dishevelled in the cytosol. Frizzled proteins and the genes encoding them have been identified in an array of animals, from sponges to humans. Frizzled proteins play key roles in governing cell polarity, embryonic development, formation of neural synapses, cell proliferation, and many other processes in developing and adult organisms. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes.

Size / Price
Каталог: HG15229-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».