Быстрый заказ

Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FUOM Информация о продукте «Клон cDNA»
Размер кДНК:465bp
Описание кДНК:Full length Clone DNA of Homo sapiens fucose mutarotase with N terminal Flag tag.
Синоним гена:FUCU, FucM, C10orf125
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13974-ACGRBS15400
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13974-ACRRBS15400
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13974-ANGRBS15400
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13974-ANRRBS15400
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13974-CFRBS13340
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13974-CHRBS13340
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13974-CMRBS13340
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13974-CYRBS13340
Человек FUOM / fucose mutarotase / FucM Джин клон кДНК в вектор клонированияHG13974-GRBS5130
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13974-NFRBS13340
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13974-NHRBS13340
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13974-NMRBS13340
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13974-NYRBS13340
Человек FUOM / fucose mutarotase / FucM Джин ORF экспрессии кДНК клона плазмидыHG13974-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

FUOM, also known as fucose mutarotase and FucM, belongs to the RbsD / FucU family. FUOM is involved in the interconversion between alpha- and beta-L-fucoses. L-Fucose has two isforms: alpha-L-fucose (29.5%) and beta-L-fucose (70.5%). The beta-form is metabolized through the salvage pathway. GDP-L-fucose formed either by the de novo or salvage pathways is transported into the endoplasmic reticulum, where it serves as a substrate for N- and O-glycosylations by fucosyltransferases. Fucosylated structures expressed on cell surfaces or secreted in biological fluids are believed to play a critical role in cell-cell adhesion and recognition processes. FUOM mainly exists as homodimer, but also functions as homotetramer, homooctamer, and homodecamer. FUOM's homodimeric form seems catalytically inactive.

  • Deloukas P. et al., 2004, Nature. 429: 375-81.
  • Ota T. et al., 2004, Nat Genet. 36: 40-5.
  • Dongkyu Park. et al., 2007, Glycobiology. 17 (9): 955-62.
  • Size / Price
    Каталог: HG13974-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.