Быстрый заказ

Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек FUK Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_145059
    Размер кДНК:3255bp
    Описание кДНК:Full length Clone DNA of Homo sapiens fucokinase.
    Синоним гена:FLJ39408
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FUK qPCR primers for gene expression analysis, HP101559 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12023-ACGRBS22240
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12023-ACRRBS22240
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12023-ANGRBS22240
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12023-ANRRBS22240
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12023-CFRBS20190
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12023-CHRBS20190
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12023-CMRBS20190
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12023-CYRBS20190
    Человек FUK/fucokinase Джин клон кДНК в вектор клонированияHG12023-GRBS5130
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12023-NFRBS20190
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12023-NHRBS20190
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12023-NMRBS20190
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12023-NYRBS20190
    Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмидыHG12023-UTRBS20190
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG12023-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».