After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FUK Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_145059
Размер кДНК:3255bp
Описание кДНК:Full length Clone DNA of Homo sapiens fucokinase.
Синоним гена:FLJ39408
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12023-ACGRBS22238
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12023-ACRRBS22238
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12023-ANGRBS22238
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12023-ANRRBS22238
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12023-CFRBS20185
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12023-CHRBS20185
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12023-CMRBS20185
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12023-CYRBS20185
Человек FUK/fucokinase Джин клон кДНК в вектор клонированияHG12023-GRBS5132
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12023-NFRBS20185
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12023-NHRBS20185
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12023-NMRBS20185
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12023-NYRBS20185
Человек FUK/fucokinase Джин ORF экспрессии кДНК клона плазмидыHG12023-UTRBS20185
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12023-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».