After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FSTL5 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_020116.3
Размер кДНК:2544bp
Описание кДНК:Full length Clone DNA of Homo sapiens follistatin-like 5 with C terminal His tag.
Синоним гена:FSTL5
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13408-ACGRBS22240
Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13408-ACRRBS22240
Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13408-CFRBS20190
Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13408-CHRBS20190
Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13408-CMRBS20190
Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13408-CYRBS20190
Человек FSTL5 Джин клон кДНК в вектор клонированияHG13408-GRBS5130
Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13408-NFRBS20190
Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13408-NHRBS20190
Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13408-NMRBS20190
Человек FSTL5 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13408-NYRBS20190
Человек FSTL5 Джин ORF экспрессии кДНК клона плазмидыHG13408-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

FSTL5 may have molecular function (calcium ion binding) and to localize in various compartments (cytoplasm, extracellular space, extracellular region). FSTL5 expression denoted a dismal prognosis both within and across medulloblastoma subgroups. FSTL5 gene is well expressed, 1.0 times the average gene in this release. The sequence of this gene is defined by 120 GenBank accessions from 113 cDNA clones, some from brain, cerebellum, eye, melanotic melanoma, skin, amygdala, breast and 24 other tissues. FSTL5 gene contains 27 distinct introns. The addition of FSTL5 immunohistochemistry to existing molecular stratification schemes constitutes a reliable and cost-effective tool for prognostication in future clinical trials of medulloblastoma.

Ссылки
  • Masuda T, et al. (2009) Laser capture microdissection and cDNA array analysis for identification of mouse KIAA/FLJ genes differentially expressed in the embryonic dorsal spinal cord. Brain Res. 1249:61-7.
  • Kingwell K. (2011) FSTL5--a new prognostic biomarker for medulloblastoma. Nat Rev Neurol. 7(11):598.
  • Remke M, et al. (2011) FSTL5 is a marker of poor prognosis in non-WNT/non-SHH medulloblastoma. J Clin Oncol. 29(29):3852-61.
  • Size / Price
    Каталог: HG13408-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    Наличие2-3 weeks
    Запрос по оптовому заказуДобавить в корзину
    Contact Us
    Изображения
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».