After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FRG1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC053997
Размер кДНК:777bp
Описание кДНК:Full length Clone DNA of Homo sapiens FSHD region gene 1 DNA.
Синоним гена:FSG1, FRG1A
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15246-ACGRBS15400
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15246-ACRRBS15400
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15246-ANGRBS15400
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15246-ANRRBS15400
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15246-CFRBS13340
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15246-CHRBS13340
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15246-CMRBS13340
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15246-CYRBS13340
Человек FRG1 Джин клон кДНК в вектор клонированияHG15246-GRBS5130
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15246-NFRBS13340
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15246-NHRBS13340
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15246-NMRBS13340
Человек FRG1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15246-NYRBS13340
Человек FRG1 Джин ORF экспрессии кДНК клона плазмидыHG15246-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15246-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».