After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FREM1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_144966.4
Размер кДНК:1268bp
Описание кДНК:Full length Clone DNA of Homo sapiens FRAS1 related extracellular matrix 1.
Синоним гена:QBRICK, C9orf143, C9orf145, C9orf154, FLJ25461, RP11-439N12.3, FREM1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11179-ACGRBS15400
Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11179-ACRRBS15400
Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11179-CFRBS13340
Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11179-CHRBS13340
Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11179-CMRBS13340
Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11179-CYRBS13340
Человек FREM1 Джин клон кДНК в вектор клонированияHG11179-MRBS5130
Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11179-NFRBS13340
Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11179-NHRBS13340
Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11179-NMRBS13340
Человек FREM1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11179-NYRBS13340
Человек FREM1 Джин ORF экспрессии кДНК клона плазмидыHG11179-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11179-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».