Быстрый заказ

Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек FOXRED2 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC040351
    Размер кДНК:2055bp
    Описание кДНК:Full length Clone DNA of Homo sapiens FAD-dependent oxidoreductase domain containing 2.
    Синоним гена:ERFAD, FOXRED2
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FOXRED2 qPCR primers for gene expression analysis, HP101998 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13290-ACGRBS16760
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13290-ACRRBS16760
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13290-ANGRBS16760
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13290-ANRRBS16760
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13290-CFRBS14710
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13290-CHRBS14710
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13290-CMRBS14710
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13290-CYRBS14710
    Человек FOXRED2 Джин клон кДНК в вектор клонированияHG13290-GRBS5130
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13290-NFRBS14710
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13290-NHRBS14710
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13290-NMRBS14710
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13290-NYRBS14710
    Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмидыHG13290-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG13290-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».