After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FOXRED2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC040351
Размер кДНК:2055bp
Описание кДНК:Full length Clone DNA of Homo sapiens FAD-dependent oxidoreductase domain containing 2.
Синоним гена:ERFAD, FOXRED2
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13290-ACGRBS16760
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13290-ACRRBS16760
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG13290-ANGRBS16760
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG13290-ANRRBS16760
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13290-CFRBS14710
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13290-CHRBS14710
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13290-CMRBS14710
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13290-CYRBS14710
Человек FOXRED2 Джин клон кДНК в вектор клонированияHG13290-GRBS5130
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13290-NFRBS14710
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13290-NHRBS14710
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13290-NMRBS14710
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13290-NYRBS14710
Человек FOXRED2 Джин ORF экспрессии кДНК клона плазмидыHG13290-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13290-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».