After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FOXP3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_014009.3
Размер кДНК:1296bp
Описание кДНК:Full length Clone DNA of Homo sapiens forkhead box P3 with C terminal Flag tag.
Синоним гена:JM2, AIID, IPEX, PIDX, XPID, DIETER, MGC141961, MGC141963, FOXP3
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:pCMV3-FOXP3-Flag
Участок рестрикции:KpnI + XbaI (6kb + 1.34kb)
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Human FOXP3 Gene Plasmid Map
Human FOXP3 natural ORF mammalian expression plasmid, C-Flag tag
Human FOXP3 Gene Expression validated Image
Human FOXP3 ORF mammalian expression plasmid, C-Flag tag
[Щелкните, чтобы увеличить изображение]
Caption:
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11652-ACGRBS15400
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11652-ACRRBS15400
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG11652-ANGRBS15400
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG11652-ANRRBS15400
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11652-CFRBS13340
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11652-CHRBS13340
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11652-CMRBS13340
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11652-CYRBS13340
Человек FOXP3 Джин клон кДНК в вектор клонированияHG11652-GRBS5130
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11652-NFRBS13340
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11652-NHRBS13340
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11652-NMRBS13340
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11652-NYRBS13340
Человек FOXP3 Джин ORF экспрессии кДНК клона плазмидыHG11652-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG11652-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
НаличиеIn Stock
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
  • Human FOXP3 natural ORF mammalian expression plasmid, C-Flag tag
  • Human FOXP3 ORF mammalian expression plasmid, C-Flag tag
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».