After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FOXP2 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_021804.1
Размер кДНК:2148bp
Описание кДНК:Full length Clone DNA of Homo sapiens forkhead box P2.
Синоним гена:CAGH44
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG12029-ACGRBS16760
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG12029-ACRRBS16760
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG12029-ANGRBS16760
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG12029-ANRRBS16760
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12029-CFRBS14710
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG12029-CHRBS14710
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG12029-CMRBS14710
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG12029-CYRBS14710
Человек FOXP2 Джин клон кДНК в вектор клонированияHG12029-GRBS5130
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG12029-G-FRBS14710
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG12029-NFRBS14710
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG12029-NHRBS14710
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG12029-NMRBS14710
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG12029-NYRBS14710
Человек FOXP2 Джин ORF экспрессии кДНК клона плазмидыHG12029-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG12029-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».