After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FOXJ3 Информация о продукте «Клон cDNA»
Размер кДНК:1869bp
Описание кДНК:Full length Clone DNA of Homo sapiens forkhead box J3 with C terminal Myc tag.
Синоним гена:MGC165036, MGC176686, FOXJ3
Участок рестрикции:
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14150-ACGRBS16760
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14150-ACRRBS16760
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14150-ANGRBS16760
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14150-ANRRBS16760
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14150-CFRBS14710
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14150-CHRBS14710
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14150-CMRBS14710
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14150-CYRBS14710
Человек FOXJ3 Джин клон кДНК в вектор клонированияHG14150-GRBS5130
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14150-NFRBS14710
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14150-NHRBS14710
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14150-NMRBS14710
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14150-NYRBS14710
Человек FOXJ3 Джин ORF экспрессии кДНК клона плазмидыHG14150-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14150-CM
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.