After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FOXA3 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC016024
Размер кДНК:1053bp
Описание кДНК:Full length Clone DNA of Homo sapiens forkhead box A3.
Синоним гена:FKHH3, HNF3G, MGC10179, TCF3G, FOXA3
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14217-ACGRBS15400
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14217-ACRRBS15400
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14217-ANGRBS15400
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14217-ANRRBS15400
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14217-CFRBS13343
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14217-CHRBS13343
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14217-CMRBS13343
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14217-CYRBS13343
Человек FOXA3 Джин клон кДНК в вектор клонированияHG14217-GRBS5130
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14217-NFRBS13343
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14217-NHRBS13343
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14217-NMRBS13343
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14217-NYRBS13343
Человек FOXA3 Джин ORF экспрессии кДНК клона плазмидыHG14217-UTRBS13343
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14217-UT
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».