Быстрый заказ

Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Человек FOLR2 Информация о продукте «Клон cDNA»
Размер кДНК:768bp
Описание кДНК:Full length Clone DNA of Homo sapiens folate receptor 2 (fetal) with N terminal Flag tag.
Синоним гена:FR-P3, FR-BETA, BETA-HFR, FBP/PL-1, FOLR2
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
( We provide with FOLR2 qPCR primers for gene expression analysis, HP101120 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag Метка on other vectors
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11219-ACGRBS15400
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11219-ACRRBS15400
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11219-CFRBS13340
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11219-CHRBS13340
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11219-CMRBS13340
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11219-CYRBS13340
Человек FOLR2 Джин клон кДНК в вектор клонированияHG11219-MRBS5130
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11219-M-FRBS13340
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11219-NFRBS13340
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11219-NHRBS13340
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11219-NMRBS13340
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11219-NYRBS13340
Человек FOLR2 Джин ORF экспрессии кДНК клона плазмидыHG11219-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name

Folate receptor beta, also known as Folate receptor 2, FBP, and FOLR2, is a member of the folate receptor family. FOLR2 is expressed in placenta and hematopoietic cells. The expression of FOLR2 is increased in malignant tissues. Members of the Folate receptor family members (FOLRs) have a high affinity for folic acid and for several reduced folic acid derivatives. They mediate the delivery of 5-methyltetrahydrofolate to the interior of, out of within, or between cells in a process known as potocytosis. FOLR2 has a 68% and 79% sequence homology with the FOLR1 and FOLR3 proteins, respectively. The FOLR2 protein was originally thought to exist only in placenta, but is also detected in spleen, bone marrow, and thymus. FOLR2 is a marker for macrophages generated in the presence of M-CSF, but not GM-CSF. Its expression correlates with increased folate uptake ability. Folate conjugates of therapeutic drugs are a potential immunotherapy tool to target tumor-associated macrophages.

  • van Heyningen V, et al., 1995, Cytogenet Cell Genet. 69 (3-4): 127-58.
  • Sabharanjak, S. et al., 2004, Adv Drug Deliv Rev. 56 (8): 1099-109. 
  • Scapoli, L. et al., 2005, Am J Med Genet A. 132A (3): 302-4.
  • Puig-Kröger, A. et al., 2009, Cancer Res  69 (24): 9395-403.
  • Size / Price
    Каталог: HG11219-NF
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.