Быстрый заказ

Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка

  • other Green fluorescent protein / GFP Gene Plasmid Map 5611
ПаспортОбзорыСвязанные продуктыПротоколы
Человек FOLR1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_016725.1
Размер кДНК:819 bp
Описание кДНК:Full length Clone DNA of Homo sapiens folate receptor 1 (adult) with C terminal Myc tag.
Синоним гена:FBP,Folate Binding Protein,FOLR
Виды:Human
переносчик:pCMV3-C-Myc
Plasmid:pCMV3-FOLR1-Myc
Участок рестрикции:KpnI + XbaI(6kb+0.82kb)
Последовательность меток:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Описание последовательности:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with FOLR1 qPCR primers for gene expression analysis, HP101185 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at ambient temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc Метка on other vectors
Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG11241-ACGRBS15400
Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG11241-ACRRBS15400
Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG11241-CFRBS13340
Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG11241-CHRBS13340
Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG11241-CMRBS13340
Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG11241-CYRBS13340
Человек Folate Binding Белок/FOLR1 Джин клон кДНК в вектор клонированияHG11241-MRBS5130
Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG11241-NFRBS13340
Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG11241-NHRBS13340
Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG11241-NMRBS13340
Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG11241-NYRBS13340
Человек Folate Binding Белок/FOLR1 Джин ORF экспрессии кДНК клона плазмидыHG11241-UTRBS13340
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

The protein encoded by FOLR1 gene is a member of the folate receptor family. Members of this gene family bind folic acid and its reduced derivatives, and transport 5-methyltetrahydrofolate into cells. This gene product is a secreted protein that either anchors to membranes via a glycosyl-phosphatidylinositol linkage or exists in a soluble form. Mutations in this gene have been associated with neurodegeneration due to cerebral folate transport deficiency. Due to the presence of two promoters, multiple transcription start sites, and alternative splicing, multiple transcript variants encoding the same protein have been found for this gene.
Folate receptor α (FRα) is the most important subunit of Folate receptor and the alpha isoform has been shown to be selectively overexpressed in cancer types like breast and ovarian cancer compared to normal breast and ovarian epithelial cells. It was determined that Folate receptor α exhibits a limited expression on the apical surfaces of the epithelial cells of normal lung, breast, thyroid, parathyroid, and kidney tissues. For their uptake of folate, normal cells rely almost exclusively on the reduced folate carrier, whereas many carcinomas and myeloid leukemia cells overexpress a high-affinity FR on their surfaces, perhaps reflecting their increased need for folate to support rapid cell division

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Ссылки
  • Senol S, Ceyran AB, Aydin A, et al. Folate receptor α expression and significance in endometrioid endometrium carcinoma and endometrial hyperplasia. International Journal of Clinical and Experimental Pathology. 2015;8(5):5633-5641.
  • Size / Price
    Каталог: HG11241-CM
    Цена по прейскуранту: 
    Цена:      (You Save: )
    Размер:
    Количество:+-
    НаличиеIn Stock
    Добавить в корзинуЗапрос по оптовому заказу

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».