FNDC4 cDNA ORF Clone, Human, N-Myc tag

Price:
Size:
Number:

FNDC4 cDNA ORF Clone, Human, N-Myc tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
705 bp
Description
Full length Clone DNA of Human fibronectin type III domain containing 4 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FNDC4 cDNA ORF Clone, Human, N-Myc tag: Alternative Names

FRCP1 cDNA ORF Clone, Human

FNDC4 Background Information

FNDC4 acts as an anti-inflammatory factor on macrophages and improves mouse model of induced colitis. FNDC4 could suppress osteoclast formation via NF-kappaB pathway and downregulation of CXCL1. Analysis of binding of FNDC4 to different immune cell types reveals strong and specific binding to macrophages and monocytes. FNDC4 treatment of bone marrow-derived macrophages in vitro results in reduced phagocytosis, increased cell survival and reduced proinflammatory chemokine expression. Hence, treatment with FNDC4 results in a state of dampened macrophage activity, while enhancing their survival. That FNDC4 may be a factor with direct therapeutic potential in inflammatory bowel disease and possibly other inflammatory diseases.
Full Name
fibronectin type III domain containing 4
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait