Быстрый заказ

Text Size:AAA

Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FMO3 Информация о продукте «Клон cDNA»
Размер кДНК:1599bp
Описание кДНК:Full length Clone DNA of Homo sapiens flavin containing monooxygenase 3 with N terminal His tag.
Синоним гена:TMAU, FMOII, dJ127D3.1
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, N-His Метка on other vectors
Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14846-ACGRBS16764
Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14846-ACRRBS16764
Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14846-CFRBS14711
Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14846-CHRBS14711
Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14846-CMRBS14711
Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14846-CYRBS14711
Человек FMO3 Джин клон кДНК в вектор клонированияHG14846-GRBS5132
Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14846-NFRBS14711
Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14846-NHRBS14711
Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14846-NMRBS14711
Человек FMO3 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14846-NYRBS14711
Человек FMO3 Джин ORF экспрессии кДНК клона плазмидыHG14846-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14846-NH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.