Быстрый заказ

Text Size:AAA

Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FMO1 Информация о продукте «Клон cDNA»
Размер кДНК:1599bp
Описание кДНК:Full length Clone DNA of Homo sapiens flavin containing monooxygenase 1 with C terminal HA tag.
Синоним гена:FMO1
Участок рестрикции:
Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15185-ACGRBS16760
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15185-ACRRBS16760
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15185-ANGRBS16760
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15185-ANRRBS16760
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15185-CFRBS14710
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15185-CHRBS14710
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15185-CMRBS14710
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15185-CYRBS14710
Человек FMO1 Джин клон кДНК в вектор клонированияHG15185-GRBS5130
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15185-NFRBS14710
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15185-NHRBS14710
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15185-NMRBS14710
Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15185-NYRBS14710
Человек FMO1 Джин ORF экспрессии кДНК клона плазмидыHG15185-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG15185-CY
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.