Быстрый заказ

Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек FMO1 Информация о продукте «Клон cDNA»
    Размер кДНК:1599bp
    Описание кДНК:Full length Clone DNA of Homo sapiens flavin containing monooxygenase 1 with C terminal HA tag.
    Синоним гена:FMO1
    Участок рестрикции:
    Последовательность меток:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Описание последовательности:
    ( We provide with FMO1 qPCR primers for gene expression analysis, HP103811 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA Метка on other vectors
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15185-ACGRBS16760
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15185-ACRRBS16760
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15185-ANGRBS16760
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15185-ANRRBS16760
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15185-CFRBS14710
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15185-CHRBS14710
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15185-CMRBS14710
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15185-CYRBS14710
    Человек FMO1 Джин клон кДНК в вектор клонированияHG15185-GRBS5130
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15185-NFRBS14710
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15185-NHRBS14710
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15185-NMRBS14710
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15185-NYRBS14710
    Человек FMO1 Джин ORF экспрессии кДНК клона плазмидыHG15185-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15185-CY
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.