After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FLT1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_001159920.1
Размер кДНК:2064bp
Описание кДНК:Full length Clone DNA of Homo sapiens fms-related tyrosine kinase 1 transcript variant 2 with C terminal Flag tag.
Синоним гена:FLT, FLT-1, VEGFR1, VEGFR-1
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13935-ACGRBS16764
Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13935-ACRRBS16764
Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13935-CFRBS14711
Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13935-CHRBS14711
Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13935-CMRBS14711
Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13935-CYRBS14711
Человек VEGFR1/FLT-1 transcript variant 2 Джин клон кДНК в вектор клонированияHG13935-GRBS5132
Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13935-NFRBS14711
Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13935-NHRBS14711
Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13935-NMRBS14711
Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13935-NYRBS14711
Человек VEGFR1/FLT-1 transcript variant 2 Джин ORF экспрессии кДНК клона плазмидыHG13935-UTRBS14711
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Фон

Vascular endothelial growth factor receptor 1, also known as VEGFR-1, Fms-like tyrosine kinase 1, Tyrosine-protein kinase FRT, Tyrosine-protein kinase receptor FLT, Vascular permeability factor receptor and FLT1, is a single-pass type I membrane protein and secreted protein which belongs to the protein kinase superfamily, Tyr protein kinase family and CSF-1/PDGF receptor subfamily. VEGFR-1 / FLT1 contains seven Ig-like C2-type (immunoglobulin-like) domains and one protein kinase domain. VEGFR-1 / FLT1 is expressed mostly in normal lung, but also in placenta, liver, kidney, heart and brain tissues. It is specifically expressed in most of the vascular endothelial cells, and also expressed in peripheral blood monocytes. VEGFR-1 / FLT1 is not expressed in tumor cell lines. VEGFR-1 / FLT1 is an essential receptor tyrosine kinase that regulates mammalian vascular development and embryogenesis. EGF-induced angiogenesis requires inverse regulation of VEGFR-1 and VEGFR-2 in tumor-associated endothelial cells. VEGFR-1 / FLT1 is a receptor for VEGF, VEGFB and PGF. It has a tyrosine-protein kinase activity. The VEGF-kinase ligand/receptor signaling system plays a key role in vascular development and regulation of vascular permeability.

Size / Price
Каталог: HG13935-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».