FKBPL cDNA ORF Clone, Human, untagged

Price:
Size:
Number:

FKBPL cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1050 bp
Description
Full length Clone DNA of Human FK506 binding protein like.
Plasmid
Promoter
Enhanced CMV promoter
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

FKBPL cDNA ORF Clone, Human, untagged: Alternative Names

DIR1 cDNA ORF Clone, Human; NG7 cDNA ORF Clone, Human; WISP39 cDNA ORF Clone, Human
Add to Cart Successfully Add to Cart Failed