After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Human FKBPL natural ORF mammalian expression plasmid

ПаспортОбзорыСвязанные продуктыПротоколы
Human FKBPL Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC004168
Размер кДНК:1050bp
Описание кДНК:Full length Clone DNA of Homo sapiens FK506 binding protein like.
Синоним гена:DADB-220I18.2, DIR1, NG7, WISP39, FKBPL
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Size / Price
Каталог: HG14215-UT
Цена по прейскуранту:   (Save )
Цена:      [How to order]
Наличие2-3 weeksИнструкции по доставке
Изображения
      Недавно просмотренные товары
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».