Быстрый заказ

Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FKBP10 Информация о продукте «Клон cDNA»
Размер кДНК:1749bp
Описание кДНК:Full length Clone DNA of Homo sapiens FK506 binding protein 10, 65 kDa with C terminal His tag.
Синоним гена:OI6, FKBP65, PPIASE, hFKBP65, FKBP10
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG13404-ACGRBS16760
Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG13404-ACRRBS16760
Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG13404-CFRBS14710
Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG13404-CHRBS14710
Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG13404-CMRBS14710
Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG13404-CYRBS14710
Человек FKBP10 Джин клон кДНК в вектор клонированияHG13404-GRBS5130
Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG13404-NFRBS14710
Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG13404-NHRBS14710
Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG13404-NMRBS14710
Человек FKBP10 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG13404-NYRBS14710
Человек FKBP10 Джин ORF экспрессии кДНК клона плазмидыHG13404-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG13404-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.