After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FILIP1L Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC027860
Размер кДНК:2682bp
Описание кДНК:Full length Clone DNA of Homo sapiens filamin A interacting protein 1-like with C terminal Flag tag.
Синоним гена:DOC1, DOC-1, GIP90, GIP130, GIP130a, GIP130b, GIP130c, FILIP1L
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, C-Flag Метка on other vectors
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG14428-ACGRBS22240
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG14428-ACRRBS22240
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG14428-ANGRBS22240
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG14428-ANRRBS22240
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG14428-CFRBS20190
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG14428-CHRBS20190
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG14428-CMRBS20190
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG14428-CYRBS20190
Человек FILIP1L Джин клон кДНК в вектор клонированияHG14428-GRBS5130
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG14428-NFRBS20190
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG14428-NHRBS20190
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG14428-NMRBS20190
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG14428-NYRBS20190
Человек FILIP1L Джин ORF экспрессии кДНК клона плазмидыHG14428-UTRBS20190
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG14428-CF
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».