After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

ПаспортОбзорыСвязанные продуктыПротоколы
Human FILIP1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:NM_015687.2
Размер кДНК:3642bp
Описание кДНК:Full length Clone DNA of Homo sapiens filamin A interacting protein 1 with C terminal His tag.
Синоним гена:FILIP, KIAA1275, FILIP1
Виды:Human
переносчик:pCMV3-C-His
Plasmid:
Участок рестрикции:
Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10444-ACGRBS25660
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10444-ACRRBS25660
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10444-ANGRBS25660
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10444-ANRRBS25660
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10444-CFRBS23610
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10444-CHRBS23610
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10444-CMRBS23610
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10444-CYRBS23610
Человек FLIP/CFLAR Джин клон кДНК в вектор клонированияHG10444-MRBS5130
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10444-M-FRBS23610
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10444-NFRBS23610
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10444-NHRBS23610
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10444-NMRBS23610
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10444-NYRBS23610
Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмидыHG10444-UTRBS23610
 Узнайте больше о векторов экспрессии,
Product nameProduct name
Size / Price
Каталог: HG10444-CH
Цена по прейскуранту: 
Цена:      (You Save: )
Размер:
Количество:+-
Наличие2-3 weeks
Запрос по оптовому заказуДобавить в корзину
Contact Us
Изображения
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».