Быстрый заказ

Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-His Метка

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек FILIP1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:NM_015687.2
    Размер кДНК:3642bp
    Описание кДНК:Full length Clone DNA of Homo sapiens filamin A interacting protein 1 with C terminal His tag.
    Синоним гена:FILIP, KIAA1275, FILIP1
    Виды:Human
    переносчик:pCMV3-C-His
    Plasmid:
    Участок рестрикции:
    Последовательность меток:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FILIP1 qPCR primers for gene expression analysis, HP100473 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-His Метка on other vectors
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG10444-ACGRBS25660
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG10444-ACRRBS25660
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG10444-ANGRBS25660
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG10444-ANRRBS25660
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10444-CFRBS23610
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG10444-CHRBS23610
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG10444-CMRBS23610
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG10444-CYRBS23610
    Человек FLIP/CFLAR Джин клон кДНК в вектор клонированияHG10444-MRBS5130
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG10444-M-FRBS23610
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG10444-NFRBS23610
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG10444-NHRBS23610
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG10444-NMRBS23610
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG10444-NYRBS23610
    Человек FLIP/CFLAR Джин ORF экспрессии кДНК клона плазмидыHG10444-UTRBS23610
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG10444-CH
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».