Быстрый заказ

Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды

    ПаспортОбзорыСвязанные продуктыПротоколы
    Человек FIGNL1 Информация о продукте «Клон cDNA»
    Gene_bank_ref_id:BC051867
    Размер кДНК:2025bp
    Описание кДНК:Full length Clone DNA of Homo sapiens fidgetin-like 1 DNA.
    Синоним гена:FIGNL1
    Виды:Human
    переносчик:pCMV3-untagged
    Plasmid:
    Участок рестрикции:
    Последовательность меток:
    Описание последовательности:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with FIGNL1 qPCR primers for gene expression analysis, HP103832 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Склад:The lyophilized plasmid can be stored at room temperature for three months.
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15206-ACGRBS16760
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15206-ACRRBS16760
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15206-ANGRBS16760
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15206-ANRRBS16760
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15206-CFRBS14710
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15206-CHRBS14710
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15206-CMRBS14710
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15206-CYRBS14710
    Человек FIGNL1 Джин клон кДНК в вектор клонированияHG15206-GRBS5130
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15206-NFRBS14710
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15206-NHRBS14710
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15206-NMRBS14710
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15206-NYRBS14710
    Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмидыHG15206-UTRBS14710
     Узнайте больше о векторов экспрессии,
    Product nameProduct name
    Size / Price
    Каталог: HG15206-UT
    Цена по прейскуранту: 
    Цена:      (You Save: )

    Datasheet & Documentation

    Contact Us
      Недавно просмотренные товары
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».