After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды

ПаспортОбзорыСвязанные продуктыПротоколы
Human FIGNL1 Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC051867
Размер кДНК:2025bp
Описание кДНК:Full length Clone DNA of Homo sapiens fidgetin-like 1 DNA.
Синоним гена:FIGNL1
Виды:Human
переносчик:pCMV3-untagged
Plasmid:
Участок рестрикции:
Последовательность меток:
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды on other vectors
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-GFPSpark МеткаHG15206-ACGRBS16760
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-OFPSpark МеткаHG15206-ACRRBS16760
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-GFPSpark МеткаHG15206-ANGRBS16760
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-OFPSpark МеткаHG15206-ANRRBS16760
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-Flag МеткаHG15206-CFRBS14710
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-His МеткаHG15206-CHRBS14710
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-Myc МеткаHG15206-CMRBS14710
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, C-HA МеткаHG15206-CYRBS14710
Человек FIGNL1 Джин клон кДНК в вектор клонированияHG15206-GRBS5130
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-Flag МеткаHG15206-NFRBS14710
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-His МеткаHG15206-NHRBS14710
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-Myc МеткаHG15206-NMRBS14710
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмиды, N-HA МеткаHG15206-NYRBS14710
Человек FIGNL1 Джин ORF экспрессии кДНК клона плазмидыHG15206-UTRBS14710
 Узнайте больше о векторов экспрессии,
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».