After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Быстрый заказ

Text Size:AAA

Human FHIT ORF mammalian expression plasmid, C-Flag tag

ПаспортОбзорыСвязанные продуктыПротоколы
Human FHIT Информация о продукте «Клон cDNA»
Gene_bank_ref_id:BC032336
Размер кДНК:444bp
Описание кДНК:Full length Clone DNA of Homo sapiens fragile histidine triad with C terminal Flag tag.
Синоним гена:FRA3B, AP3Aase
Виды:Human
переносчик:pCMV3-C-FLAG
Plasmid:
Участок рестрикции:
Последовательность меток:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Описание последовательности:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Склад:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Фон

Fragile histidine triad, also known as FHIT, may play a key role in differentiating humans from apes. Fragile histidine triad gene belongs to the histidine triad gene family. It has been shown that fragile histidine triad synergizes with VHL, another tumor suppressor, in protecting against chemically - induced lung cancer. Fragile histidine triad gene works as a tumor suppressor as it has been demonstrated in animal studies. The exact molecular function of FHIT is still partially unclear. It also acts as a tumor suppressor of HER2/neu driven breast cancer.

Ссылки
  • Lambert N, et al. (2006) An RNA gene expressed during cortical development evolved rapidly in humans. Nature. 443(7108):167-72.
  • Pekarsky Y, et al. (1998) Nitrilase and Fhit homologs are encoded as fusion proteins in Drosophila melanogaster and Caenorhabditis elegans. Proc Natl Acad Sci. 95(15):8744-9.
  • Ohta M, et al. (1996) The FHIT gene, spanning the chromosome 3p14.2 fragile site and renal carcinoma-associated t(3;8) breakpoint, is abnormal in digestive tract cancers. Cell. 84(4): 587-97.
  • Size / Price
    Каталог: HG14434-CF
    Цена по прейскуранту:   (Save )
    Цена:      [How to order]
    Наличие2-3 weeks
     Инструкции по доставке
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Внимание: все продукты «ПРЕДНАЗНАЧЕНЫ ИСКЛЮЧИТЕЛЬНО ДЛЯ ИССЛЕДОВАНИЙ И НЕ ПРЕДНАЗНАЧЕНЫ ДЛЯ ДИАГНОСТИКИ ИЛИ ТЕРАПЕВТИЧЕСКОГО ЛЕЧЕНИЯ».